Journal: The Journal of Biological Chemistry

Article Title: Nrf1-mediated transcriptional regulation of the proteasome requires a functional TIP60 complex

doi: 10.1074/jbc.RA118.006290

Figure Lengend Snippet: Identification of RUVBL1 as a factor required for Nrf1 transcriptional activity. A, schematic of the reporter construct used in the cell-based screening system. This lentiviral reporter construct expressed firefly luciferase under the control of 8xARE upstream of a minimal promoter (Pmin), along with Renilla luciferase driven by the hPGK promoter. B, NIH-3T3 cells with stable incorporation of the reporter system described above and that were either wild-type (WT 8xARE-Luc) or Nrf1-deficient (Nrf1−/− 8xARE-Luc) were treated with DMSO or 200 nm CFZ overnight and analyzed by immunoblotting using antibodies specific for Nrf1, ubiquitin, and β-actin. The experiments were performed three independent times, and a representative blot is shown. C, WT 8xARE-Luc and Nrf1−/− 8xARE-Luc cells were treated for 16 h with increasing concentrations of CFZ (0, 20, 50, 100, 150, and 200 nm) and then subjected to Dual-Luciferase assays to measure the firefly and Renilla luciferase activity values. Normalized luciferase activity is shown. Error bars denote S.D. (n = 3). D, WT 8xARE-Luc cells were treated with 200 nm CFZ alone or in combination with 10 μm NMS-873 and compared with the DMSO-treated control for 16 h. The cell lysates were then used for luciferase assays. Normalized luciferase activity is shown. Error bars denote S.D. (n = 3). E, WT 8xARE-Luc cells were transfected with a focused library of siRNAs targeting several epigenetic factors and other candidate genes. Forty-eight hours after transfection, the cells were further treated with 200 nm CFZ overnight and assayed for luciferase activity. Error bars denote S.D. (n = 3). F, WT NIH-3T3 cells were either control (Ctrl)-transfected or transfected with siRNAs targeting RUVBL1 and further treated with 200 nm CFZ, as indicated, for 8 h. RNA extracted from these cells was then subjected to quantitative RT-PCR with primers specific for representative proteasome subunit genes as shown. The transcript levels of 18S rRNA were used for normalization. Error bars denote S.D. (n = 3). G, NIH-3T3 cells treated as described in F were used for immunoblotting with antibodies against Nrf1, RUVBL1, RUVBL2, ubiquitin, and β-actin as indicated. The experiments were performed three independent times, and a representative blot is shown.

Article Snippet: The antibodies used were specific for Nrf1 (1:5000), RUVBL1 (1:2500), RUVBL2 (1:2500), ubiquitin (1:3000), and cleaved caspase-3 (1:3000) (all from Cell Signaling Technology); INO80 (1:500, a gift from Dr. Landry ( 45 )); PIH1 (1:1000, Proteintech); and TIP60 (1:1500, Abcam) and β-actin (1:10,000, Sigma-Aldrich).

Techniques: Activity Assay, Construct, Luciferase, Western Blot, Transfection, Quantitative RT-PCR

Journal: The Journal of Biological Chemistry

Article Title: Nrf1-mediated transcriptional regulation of the proteasome requires a functional TIP60 complex

doi: 10.1074/jbc.RA118.006290

Figure Lengend Snippet: Depletion of RUVBL1 impairs the transcriptional function of Nrf1 in different cancer cell lines. A, the cell lines HCT116, MDA-MB-231, and MIA-PaCa2 were either control (Ctrl)-transfected or transfected with siRNAs targeting RUVBL1. Forty-eight hours after transfection, the cells were treated with 200 nm CFZ for 8 h and then analyzed by quantitative RT-PCR to measure representative proteasome subunit gene mRNA levels. The mRNA levels of 18S rRNA were used for normalization. Error bars denote S.D. (n = 3). B, the cell lines above were treated similarly as described in A and subjected to immunoblotting with antibodies specific for RUVBL1, RUVBL2, Nrf1, ubiquitin, and β-actin. The experiments were performed three independent times, and a representative blot is shown.

Article Snippet: The antibodies used were specific for Nrf1 (1:5000), RUVBL1 (1:2500), RUVBL2 (1:2500), ubiquitin (1:3000), and cleaved caspase-3 (1:3000) (all from Cell Signaling Technology); INO80 (1:500, a gift from Dr. Landry ( 45 )); PIH1 (1:1000, Proteintech); and TIP60 (1:1500, Abcam) and β-actin (1:10,000, Sigma-Aldrich).

Techniques: Transfection, Quantitative RT-PCR, Western Blot

Journal: The Journal of Biological Chemistry

Article Title: Nrf1-mediated transcriptional regulation of the proteasome requires a functional TIP60 complex

doi: 10.1074/jbc.RA118.006290

Figure Lengend Snippet: Nrf1 interacts with the TIP60 complex. A, WT and Nrf1−/− NIH-3T3 cell lines were treated with 200 nm CFZ for 8 h. The cells were then subjected to ChIP with IgG, Nrf1, RUVBL1, or TIP60 antibodies. These samples were then analyzed by quantitative PCR with primers specific for ARE-containing promoter regions of the proteasome genes PSMA7, PSMB7, and PSMD12. Error bars denote S.D. (n = 3). B, HEK293 cells stably expressing tagged Nrf1 (Nrf13xFLAG) were treated with 200 nm CFZ for 8 h or left untreated. The cell lysates were then subjected to immunoprecipitation with anti-FLAG beads and analyzed by immunoblotting with antibodies specific for FLAG, RUVBL1, and RUVBL2. The lysate lanes were loaded with 5% of the input that was used for immunoprecipitation. The experiments were performed three independent times, and a representative blot is shown.

Article Snippet: The antibodies used were specific for Nrf1 (1:5000), RUVBL1 (1:2500), RUVBL2 (1:2500), ubiquitin (1:3000), and cleaved caspase-3 (1:3000) (all from Cell Signaling Technology); INO80 (1:500, a gift from Dr. Landry ( 45 )); PIH1 (1:1000, Proteintech); and TIP60 (1:1500, Abcam) and β-actin (1:10,000, Sigma-Aldrich).

Techniques: Real-time Polymerase Chain Reaction, Stable Transfection, Expressing, Immunoprecipitation, Western Blot

Journal: bioRxiv

Article Title: Influenza A virus polymerase co-opts distinct sets of host proteins for RNA transcription or replication

doi: 10.1101/2025.06.06.658254

Figure Lengend Snippet: HMGB2, RUVBL2, and RPAP2 promote IAV polymerase activity. A) Minigenome reporter assay in eHAP WT cells transfected with a non-targeting siRNA (siNT), two siRNA pools targeting both ANP32A and ANP32B (siANP32.1 and siANP32.2), or siRNA pools targeting 31 genes enriched in WT cells or 2 genes enriched in both WT and ANP32-KO cells. Cells were transfected with plasmids to reconstitute PR8 polymerase activity. Firefly luciferase activity was normalized to co-transfected Renilla luciferase levels. Putative replication-specific proviral factors are shown in green, replication-specific antiviral factors in red, and transcription-specific proviral factors in blue. Statistical significance was assessed compared to siNT using an unpaired t test. B-I) Minigenome reporter assay in A549 WT and HMGB2-KO cells (B-E) or WT and RUVBL2-KO cells (F-I) transfected with plasmids to reconstitute PR8 (B and F), Vic75 (C and G), Eng195 (D and H), and Tky05 (E and I) polymerase activity. Firefly luciferase activity was normalized to co-transfected Renilla luciferase levels. Statistical significance was assessed compared to WT using an unpaired t test. J-O) Accumulation of segment 4 (Haemagglutinin (HA)) vRNA (J and M), cRNA (K and N), and mRNA (L and O) in A549 WT and RPAP2-KO cells (J-L) or WT and HMGB2-KO cells (M-O) following infection with PR8 (MOI=3). Data is shown as the fold change over input (0hpi). Statistical significance was assessed at each timepoint following log transformation using multiple unpaired t tests, corrected for multiple comparisons using the FDR. For all panels: Data is shown as mean of n=3 technical repeats, representative of n=3 biological repeats. ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001. See also Figure S4 and S5.

Article Snippet: Primary antibodies used were rabbit IZ-vinculin (EPR8185; Abcam), rabbit IZ-PB2 (GTX125926; Genetex), rabbit IZ-HMGB2 (EPR6301; Abcam), rabbit IZ-RUVBL2 (10195-1-AP; ThermoFisher Scientific), mouse IZ-tubulin (AB7291; Abcam), mouse IZ-FLAG (F1804, Sigma).

Techniques: Activity Assay, Reporter Assay, Transfection, Luciferase, Infection, Transformation Assay

Journal: bioRxiv

Article Title: Influenza A virus polymerase co-opts distinct sets of host proteins for RNA transcription or replication

doi: 10.1101/2025.06.06.658254

Figure Lengend Snippet: HMGB2 and RUVBL2 are replication-specific cofactors and RPAP2 is a transcription-specific cofactor. A) Schematic showing vRNA, cRNA, and mRNA synthesis in a minigenome setup with a WT, replication-deficient (PA E410A), or transcription-deficient (PA D108A) polymerase. B and C) cRNA:vRNA ratio (B) and mRNA:vRNA ratio (C) produced by a PR8 WT vRNP following transient knockdown of both ANP32A and ANP32B (siANP32.1 and siANP32.2), HMGB2, RUVBL2, or RPAP2. Activity of a replication-deficient vRNP (green striped) and transcription-deficient vRNP (blue striped) in cells transfected with a non-targeting siRNA (siNT) is also shown. cRNA:vRNA ratios were normalized to the ratio produced by the transcription-deficient vRNP in siNT-treated cells (B). mRNA:vRNA ratios were normalized to the ratio produced by the replication-deficient vRNP in siNT-treated cells (C). vRNA template provided was a pPolI-Firefly luciferase plasmid. Statistical significance was assessed compared to replication-deficient/transcription-deficient polymerases using an unpaired t test. D) Schematic showing vRNA, cRNA, and mRNA synthesis under conditions of a cRNP stabilization assay with cycloheximide (CHX) treatment. E-H) cRNP stabilization assay with CHX in A549 WT and HMGB2-KO cells (E and F) or WT and RPAP2-KO cells (G and H). Data is shown as fold change in segment 4 (Haemagglutinin (HA)) cRNA:vRNA ratio (E and G) and mRNA:vRNA ratio (F and H) over input (0hpi). Statistical significance was determined at each timepoint following log transformation using multiple unpaired t tests, corrected for multiple comparisons using the FDR. For (B), (C), and (E-H): Data is shown as mean of n=3 technical repeats, representative of n=3 biological repeats. ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001. See also Figure S6.

Article Snippet: Primary antibodies used were rabbit IZ-vinculin (EPR8185; Abcam), rabbit IZ-PB2 (GTX125926; Genetex), rabbit IZ-HMGB2 (EPR6301; Abcam), rabbit IZ-RUVBL2 (10195-1-AP; ThermoFisher Scientific), mouse IZ-tubulin (AB7291; Abcam), mouse IZ-FLAG (F1804, Sigma).

Techniques: Produced, Knockdown, Activity Assay, Transfection, Luciferase, Plasmid Preparation, Transformation Assay

Journal: iScience

Article Title: Adiponectin-mediated promotion of CD44 suppresses diabetic vascular inflammatory effects

doi: 10.1016/j.isci.2023.106428

Figure Lengend Snippet: Key resources table

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-reptin Cell Signaling Technology Cat#12668S; RRID: AB_2797987 Rabbit monoclonal anti-IgG Cell Signaling Technology Cat#14708S; RRID: AB_2798581 Rabbit monoclonal anti-APPL1 Cell Signaling Technology Cat#3858S; RRID: AB_2056989 Rabbit monoclonal anti-Histone 2A Cell Signaling Technology Cat#7631S; RRID: AB_10860771 Rabbit monoclonal anti-GAPDH Cell Signaling Technology Cat#5174S; RRID: AB_10622025 Rabbit monoclonal anti-β-catenin Cell Signaling Technology Cat#8480S; RRID: AB_11127855 Rabbit monoclonal anti-Non-β-catenin Cell Signaling Technology Cat#8814S; RRID: AB_11127203 NF-κB Pathway Antibody Sampler Kit Cell Signaling Technology Cat#9936T; RRID: AB_561197 Rabbit monoclonal anti-CD44 Cell Signaling Technology Cat#37259S; RRID: AB_2750879 Rabbit monoclonal anti-ICAM-1 Cell Signaling Technology Cat#67836S; RRID: AB_2799738 Biological samples Serum of Healthy control subjects and Diabetes patients Anzhen Hospital, Capital Medical University, Beijing, China https://anzhen.org/ Chemicals, peptides, and recombinant proteins Recombinant Human gAcrp30/Adipolean Peprotech.inc CAS:25-450-21 Recombinant CD44 protein ®Sangon Biotech CAS:D622619 Critical commercial assays BCA Protein Array Kit Thermo Fisher Scientific, Inc. CAS:23227 Qproteome Cell Compartment Kit CAS:37502 The Transcription Factor Activation Profiling Plate Array II Signosis, Sunnyvale, CA CAS: FA-1002 RT2 ProfilerTM PCR Array Human Transcription Factors Qiagen, USA GeneGlobe ID-PAHS-075ZA-24; CAS: 330231 ELISA Kit for Adiponectin (ADPN) Cloud-Clone Corp CAS: SEA605Hu ELISA Kit for CD44 Cloud-Clone Corp CAS: SEA670Hu EZ-Link Sulfo-NHS-LC-Biotinylation kit Thermo Fisher Scientific, Inc. CAS:21435 Deposited data Raw and analyzed data This paper GEO: GSE217607 Experimental models: Cell lines Human umbilical vein endothelial cells (HUVECs): 4201HUM-CCTCC00635 NICR http://cellresource.cn/fdetail.aspx?id=5307/ Experimental models: Organisms/strains Mouse: APPL1 −/− , 8 weeks’s old BRL Medicine Inc. N/A Mouse: APN −/− , 8 weeks’s old Gift N/A Oligonucleotides siRNA targeting sequence: APPL1 #1: UCUCACCUGACUUCGAAACU This paper N/A siRNA targeting sequence: CD44 #1: GAACAAGGAGUCGUCAGAAACUCCA This paper N/A Primers, see Table S2 This paper N/A Software and algorithms GraphPad Prism 8.0 GraphPad Software Inc., San Diego, CA https://www.graphpad.com/ SPSS Statistics 25.0 SPSS Inc., Chicago, IL https://www.ibm.com/ Open in a separate window Key resources table .

Techniques: Recombinant, Protein Array, Activation Assay, Enzyme-linked Immunosorbent Assay, Sequencing, Software

Journal: bioRxiv

Article Title: Testosterone-Induced Metabolic Changes in Seminal Vesicle Epithelial cells Alter Plasma Components to Enhance Sperm Fertility

doi: 10.1101/2024.01.16.575926

Figure Lengend Snippet: (A) Tracing of oxygen consumption rate (OCR) basal and injection with 10 nM oleic acid (OA) or OA + 40 nM Etomoxir (Eto). (B) The sperm, after 1 hour of incubation with or without seminal vesicle secretions (SV) from nontreated (Ctrl) or flutamide-treated mice(Flu), were used for IVF, and the cleavaged oocytes were observed. The absolute number of oocytes collected from the oviduct and the cleavage rate are shown. (C) Western blot analysis for phosphotyrosine (P-Tyr) in capacitated spermatozoa (Ctrl; 1-hour incubation in HTF medium) and treated with SV from healthy mice or 10 nM oleic acid (OA). (D) Quantitative analysis of GLUT4 relative to α-tubulin obtained from Western blot. (E) Flow cytometric analysis of the sperm after 1 hour incubation in control medium (HTF) and medium containing SV or 10 nM OA, using fluorescein isothiocyanate-conjugated peanut agglutinin (PNA-FITC; to distinguish between acrosome-reacted and non-reacted cells) and propidium iodide (PI; to distinguish between dead and viable cells). (F) The percentage of viable sperm with an acrosome reaction (PI-, PNA-FITC+) was evaluated by flow cytometry in the 4th quadrant (4Q; red square). Data are mean ± SEM. At least three independent replicates. Percentage data were subjected to arcsine transformation before statistical analysis. (B) Dunnett’s test was used to analyze the cleavage rate. Different letters represent significantly different groups. (D,F) Differences between groups were assessed by one-way analysis of variance (ANOVA). When ANOVA was significant, differences among values were analyzed by Tukey’s Honest Significant Difference test for multiple comparisons.

Article Snippet: The membranes were incubated overnight at 4°C with primary antibodies: anti-phosphotyrosine antibody (1:10,000; 8959; Cell Signaling), anti-GLUT4 antibody (1:100; ab33780; Abcam), anti-ACLY antibody (1:10,000; ab40793; Abcam) or anti-α/β-Tubulin antibody (1:1,000; 2148S; Cell Signaling).

Techniques: Injection, Incubation, Western Blot, Control, Flow Cytometry, Transformation Assay

Journal: JCI Insight

Article Title: Plasma cells in human pancreatic ductal adenocarcinoma secrete antibodies against self-antigens

doi: 10.1172/jci.insight.172449

Figure Lengend Snippet: ( A ) Proteins that were immunoprecipitated by recombinant antibody 19-3 from lysates of MiaPaca2 cells were separated by SDS-PAGE and visualized by silver staining. The proteins, RUVBL1 and RUVBL2, were identified by mass spectrometry. ( B ) MiaPaca2 cells were costained with 19-3 and an antibody specific for RUVBL2. ( C ) The binding of incremental concentrations of 19-3 to RUVBL2 was measured by ELISA. ( D ) Western blot analysis of recombinant antibody 15-7 detection of cytoplasmic proteins (Cyto) and mitochondria enriched proteins (Mito) is shown. ( E ) Immunofluorescence staining of MiaPaca2 cells by 15-7 and an antibody specific for HSPD1 is shown. ( F ) The binding of incremental concentrations of 15-7 to HSPD1 was measured by ELISA. ( G ) The serum IgG titers of normal individuals ( n = 61) and PDAC patients ( n = 59) to F-actin (sera diluted 1:100), to RUVBL2 (sera diluted 1:1,000), and to HSPD1 (sera diluted 1:1,000), respectively, were measured by ELISA. Background ELISA signal is indicated by dashed line. Individual data and mean are shown. The nonparametric t test was used for comparison. Each experiment was repeated at least twice. Scale bars in B and E are 50 μm.

Article Snippet: Other antibodies and dyes used were Phalloidin (Thermo Fisher Scientific, A12379), MYH10 (Atlas Antibodies, HPA047541), cytochalasin D (Thermo Fisher Scientific, PHZ1063), Actin (Cell Signaling Technology, 3700S), RUVBL2 (Atlas Antibodies, HPA067966), RUVBL1 (Atlas Antibodies, HPA019947), HSPD1 (Atlas Antibody, HPA050025), HSPA9 (Atlas Antibody, HPA000898), COX4I1 (Atlas antibody, HPA002485), KRT19 (Abcam, ab203445), and human IgG isotype controls (BioLegend, 403502 and 403702).

Techniques: Immunoprecipitation, Recombinant, SDS Page, Silver Staining, Mass Spectrometry, Binding Assay, Enzyme-linked Immunosorbent Assay, Western Blot, Immunofluorescence, Staining, Comparison